Journal: Biology Direct

Article Title: The role of SH3RF2 in lung squamous cell carcinoma and M2 polarization: insights into LZTS2 ubiquitination

doi: 10.1186/s13062-025-00677-0

Figure Lengend Snippet: ( A ) Cell viability of SKMES1 cells treated with ICG-001. ( B ) RNA level of CCL2 in SKMES1 cells. ( C ) Protein level of CCL2 in SKMES1 cells. ( D ) Cellular migration and invasion ability of THP-1 cells analyzed by transwell assay. ( E ) RNA levels of Arg-1, CD163 and IL-10 in M0 THP-1 cells treated with SKMES1 CM. ( F ) The proportion of CD206 + cells in M0 THP-1 cells with SKMES1 CM treatment. EV: empty vector, SR oe : SH3RF3 overexpression. **: p < 0.01, ***: p < 0.001

Article Snippet: Colonies were fixed with 4% paraformaldehyde at room temperature for 25 min and stained with crystal violet dye for 5 min. CCL2 levels were determined using the Human CCL2 ELISA Kit (Lianke Bio, China).

Techniques: Migration, Transwell Assay, Plasmid Preparation, Over Expression

Journal: Biology Direct

Article Title: The role of SH3RF2 in lung squamous cell carcinoma and M2 polarization: insights into LZTS2 ubiquitination

doi: 10.1186/s13062-025-00677-0

Figure Lengend Snippet: ( A & B ) SKMES1 cells with SH3RF2 overexpression or knockdown were injected subcutaneously into the right armpit of Balb/c nude mice. Tumor size was measured every 3 days. Tumors were removed and weighed after 33 days. ( C & D ) The protein level of CCL2 in tumor determined by ELISA. ( E ) Detection of SH3RF2 expression in tumor tissues by immunohistochemistry, bar = 50 μm. ( F ) Immunohistochemistry for Ki-67 in tumor tissues, bar = 50 μm. ( G ) The proportion of CD11b + F4/80 + CD206 + cells in tumor. NC sh : negative control shRNA, SR sh−1 : SH3RF2 shRNA-1, SR sh−2 : SH3RF2 shRNA-2, EV: empty vector, SR oe : SH3RF3 overexpression. **: p < 0.01, ***: p < 0.001

Article Snippet: Colonies were fixed with 4% paraformaldehyde at room temperature for 25 min and stained with crystal violet dye for 5 min. CCL2 levels were determined using the Human CCL2 ELISA Kit (Lianke Bio, China).

Techniques: Over Expression, Knockdown, Injection, Enzyme-linked Immunosorbent Assay, Expressing, Immunohistochemistry, Negative Control, shRNA, Plasmid Preparation

Journal: Biology Direct

Article Title: The role of SH3RF2 in lung squamous cell carcinoma and M2 polarization: insights into LZTS2 ubiquitination

doi: 10.1186/s13062-025-00677-0

Figure Lengend Snippet: ( A ) Protein level of LZTS2 in SKMES1 cells with SH3RF2 and LZTS2 overexpression. ( B ) Cell viability of SKMES1 cells with SH3RF2 and LZTS2 overexpression. ( C ) Immunofluorescence detection of the distribution of β-catenin in SKMES1 cells and quantitative analysis of nuclear-to-cytoplasmic ratio of β-catenin fluorescence intensity. ( D ) Protein level of CCL2 in SKMES1 cells. ( E ) RNA levels of Arg-1, CD163 and IL-10 in M0 THP-1 cells with SKMES1 CM treatment. ( F ) Cellular migration and invasion ability of M0 THP-1 cells with SKMES1 CM treatment. ( G ) The proportion of CD206 + cells in the M0 THP-1 cells treated with SKMES1 CM. EV: empty vector, SR oe : SH3RF3 overexpression. LZ oe : LZTS2 overexpression. **: p < 0.01, ***: p < 0.001

Article Snippet: Colonies were fixed with 4% paraformaldehyde at room temperature for 25 min and stained with crystal violet dye for 5 min. CCL2 levels were determined using the Human CCL2 ELISA Kit (Lianke Bio, China).

Techniques: Over Expression, Immunofluorescence, Fluorescence, Migration, Plasmid Preparation

Journal: Journal of Nanobiotechnology

Article Title: Therapies with CCL25 require controlled release via microparticles to avoid strong inflammatory reactions

doi: 10.1186/s12951-021-00830-7

Figure Lengend Snippet: Characteristic features of PLGA particles. PLGA particles were analyzed morphologically with SEM, evaluated for endotoxin contamination with the Limulus amebocyte lysate (LAL) test, and functionally assessed by their CCL25 release profile. Representative SEM images of the PLGA particles generated are shown in a i,ii with × 40 and 200 magnification at day one, iii, iv with × 40/ × 200 magnification after 14 days of degradation, v, vi with × 40/ × 200 magnification after 28 days of degradation and vii, viii with × 1000 magnification after 63 days of degradation. Scale bars represent 500 and 100 µm, respectively. b The results of the LAL test for the detection of endotoxins are shown for different stock solutions of CCL25 (10 and 500 nM) and the supernatant from PLGA particles (CL supernatant) compared to the test standards (0.1–10 nM). c The cumulative release in percent ± SD of CCL25 from PLGA particles over time until day 63 ( n = 3) was determined by ELISA. CL CCL25-loaded, PLGA Poly (lactic-co-glycolic acid)

Article Snippet: The amount of CCL25 released from the PLGA microparticles was measured using the human CCL25/TECK DuoSet® Enzyme linked immunosorbent assay (ELISA) kit (R&D Systems, Minneapolis, USA).

Techniques: Generated, Enzyme-linked Immunosorbent Assay

Journal: Frontiers in Immunology

Article Title: ACKR4 Recruits GRK3 Prior to β-Arrestins but Can Scavenge Chemokines in the Absence of β-Arrestins

doi: 10.3389/fimmu.2020.00720

Figure Lengend Snippet: General plasmids and primers.

Article Snippet: pSUMO hCCL25 , hCCL25 RC222128 (Origene) , GACTAGGTCTCCGGTGGGCAAGGTGTCTTTGAGGAC , GTGCTCGAGTTACAGTCCTGAATTAGCTGATATCAGGAGGG , -.

Techniques: Synthesized, Amplification, Plasmid Preparation

Journal: PeerJ

Article Title: CCL25/CCR9 interaction promotes the malignant behavior of salivary adenoid cystic carcinoma via the PI3K/AKT signaling pathway.

doi: 10.7717/peerj.13844

Figure Lengend Snippet: Figure 2 CCL25/CCR9 promotes the proliferation of SACC cells. (A, B) The proliferation of SACC-83 (A) and SACC-LM (B) cells treated with different concentrations of CCL25 was tested by a CCK-8 kit at 24 h and 48 h (n = 3, unpaired two-tailed t-test; P < 0.05, P < 0.01, P < 0.001). (C) Colony-forming assay was performed to detect the proliferation of SACC-83 and SACC-LM cells treated with CCL25 (n = 3, unpaired two-tailed t-test; P < 0.01, P < 0.001). (D) Quantitative analysis of the colon level of (C). (E, F) SACC-LM cells were treated with 200 ng/ml CCL25 and 10 nM CCR9 inhibitor (Vercirnon, VCN) for 48 h. The mRNA and protein expression of proliferation-related factors (Ki67, cyclin D1, and

Article Snippet: The main reagents involved in this study were CCL25 (#9046-TK-025/CF; R&D Systems Inc., Minneapolis, MN, USA), CCR9 inhibitor (Vercirnon, #GSK-1605786; MedchenExpress, Monmouth Junction, NJ, USA) and PI3K inhibitor (LY294002; Beyotime Biotechnology, Shanghai, China).

Techniques: CCK-8 Assay, Two Tailed Test, Expressing

Journal: PeerJ

Article Title: CCL25/CCR9 interaction promotes the malignant behavior of salivary adenoid cystic carcinoma via the PI3K/AKT signaling pathway.

doi: 10.7717/peerj.13844

Figure Lengend Snippet: Figure 3 CCL25/CCR9 promotes SACC-LM cell migration and invasion. (A) After SACC-LM cells were treated with different concentrations of CCL25 (0, 100, 200 ng/ml for 24 h, wound healing assays were used to test the horizontal migration ability of SACC-LM cells. (B) The wound closure area of cells after CCL25 administration was quantitatively analyzed (n = 3, unpaired two-tailed t-test; P < 0.01, P < 0.001). (C) The migration and invasion abilities were detected by Transwell assays after SACC-LM cells were treated with different concentrations of CCL25 (0, 100, 200 ng/ml) for 24 h. (D) Quantitative analysis of the number of migrated and invasive cells in (C) (n = 3, unpaired two-tailed t-test; P < 0.05, P < 0.001). (E, F) The mRNA and protein expression of vimentin, E-cadherin, MMP2 and MMP9 was measured by RT–qPCR (E) and WB (F). GAPDH was used as a standard control (n = 3, one-way ANOVA followed by Tukey’s multiple comparisons; vs Control, P < 0.001; # vs CCL25, #P < 0.05, ###P < 0.001). Data are presented as the mean ± SD. Full-size

Article Snippet: The main reagents involved in this study were CCL25 (#9046-TK-025/CF; R&D Systems Inc., Minneapolis, MN, USA), CCR9 inhibitor (Vercirnon, #GSK-1605786; MedchenExpress, Monmouth Junction, NJ, USA) and PI3K inhibitor (LY294002; Beyotime Biotechnology, Shanghai, China).

Techniques: Migration, Two Tailed Test, Expressing, Quantitative RT-PCR, Control

Journal: PeerJ

Article Title: CCL25/CCR9 interaction promotes the malignant behavior of salivary adenoid cystic carcinoma via the PI3K/AKT signaling pathway.

doi: 10.7717/peerj.13844

Figure Lengend Snippet: Figure 4 CCL25/CCR9 activates the PI3K/AKT signaling pathway in SACC-LM cells. (A) WB was used to detect the activation of signaling pathways, including p-ERK1/2 (ERK1: T202/Y204; ERK2: T185/Y187), p-AKT (Ser473) p-STAT3 (Tyr705) after SACC-LM cells were treated with/ without 10 nM Vercirnon for 48 h followed by 200 ng/ml CCL25 pretreatment. (B) Quantitative analysis of the protein level of p-AKT, p-ERK1/2 and p-STAT3 (n = 3, one-way ANOVA followed by Tukey’s multiple comparisons; P < 0.001; # vs CCL25, ##P < 0.01). Data are presented as the mean ± SD. Full-size

Article Snippet: The main reagents involved in this study were CCL25 (#9046-TK-025/CF; R&D Systems Inc., Minneapolis, MN, USA), CCR9 inhibitor (Vercirnon, #GSK-1605786; MedchenExpress, Monmouth Junction, NJ, USA) and PI3K inhibitor (LY294002; Beyotime Biotechnology, Shanghai, China).

Techniques: Activation Assay, Protein-Protein interactions

Journal: PeerJ

Article Title: CCL25/CCR9 interaction promotes the malignant behavior of salivary adenoid cystic carcinoma via the PI3K/AKT signaling pathway.

doi: 10.7717/peerj.13844

Figure Lengend Snippet: Figure 5 CCL25/CCR9 interaction enhances the proliferation and anti-apoptosis of SACC-LM cells through the PI3K/AKT pathway. (A, B) After treatment with 200 ng/ml CCL25, different concentrations of PI3K/AKT inhibitor (LY294002, LY) were added to 5 × 103

Article Snippet: The main reagents involved in this study were CCL25 (#9046-TK-025/CF; R&D Systems Inc., Minneapolis, MN, USA), CCR9 inhibitor (Vercirnon, #GSK-1605786; MedchenExpress, Monmouth Junction, NJ, USA) and PI3K inhibitor (LY294002; Beyotime Biotechnology, Shanghai, China).

Techniques:

Journal: PeerJ

Article Title: CCL25/CCR9 interaction promotes the malignant behavior of salivary adenoid cystic carcinoma via the PI3K/AKT signaling pathway.

doi: 10.7717/peerj.13844

Figure Lengend Snippet: Figure 6 CCL25/CCR9 interaction enhances the migration and invasion of SACC-LM cells through the PI3K/AKT pathway. (A–E) A total of 1 × 105 SACC-LM cells were administered 200 ng/ml CCL25, 10 nM PI3K/AKT inhibitor (LY294002) and 10 nM Vercirnon (VCN) for 48 h. The mRNA and protein expression of invasion- and metastasis-related proteins (vimentin, E-cadherin, MMP2 and MMP9) was detected by RT–qPCR (A–D) and WB (E) (n = 3, one-way ANOVA followed by Tukey’s multiple comparisons; vs Control, P < 0.001; # vs CCL25, #P < 0.05, ###P < 0.001). (F–I) The mRNA and protein expression of EMT-related transcription factors (SLUG, SNAIL1, and TWIST) was detected by RT–qPCR (F–H) and WB (I) (n = 3, one-way ANOVA followed by Tukey’s multiple comparisons; vs Control, P < 0.01, P < 0.001; # vs CCL25, ###P < 0.001). Data are presented as the mean ± SD. Full-size

Article Snippet: The main reagents involved in this study were CCL25 (#9046-TK-025/CF; R&D Systems Inc., Minneapolis, MN, USA), CCR9 inhibitor (Vercirnon, #GSK-1605786; MedchenExpress, Monmouth Junction, NJ, USA) and PI3K inhibitor (LY294002; Beyotime Biotechnology, Shanghai, China).

Techniques: Migration, Expressing, Quantitative RT-PCR, Control

Journal: PeerJ

Article Title: CCL25/CCR9 interaction promotes the malignant behavior of salivary adenoid cystic carcinoma via the PI3K/AKT signaling pathway.

doi: 10.7717/peerj.13844

Figure Lengend Snippet: Figure 7 CCL25/CCR9 promotes tumor growth in a SACC xenograft mouse model by activating the PI3K/AKT signaling pathway. (A) Schematic representation of the animal model establishment. For xenograft models, 1 × 107 SACC-LM cells in 100 ml of PBS were sub- cutaneously injected into the right flanks of mice. After 7 days of tumor cell injection, the mice were randomly divided into four groups: PBS group, CCL25 group, CCL25/VCN group and CCL25/LY group. According to the time axis, mice were administered CCL25 on Day 7 and then given CCR9 inhibitor (Vercirnon) or PI3K/AKT inhibitor (LY294002) on Days 7 and 14, respectively, around the transplanted tumor. Then, the mice were

Article Snippet: The main reagents involved in this study were CCL25 (#9046-TK-025/CF; R&D Systems Inc., Minneapolis, MN, USA), CCR9 inhibitor (Vercirnon, #GSK-1605786; MedchenExpress, Monmouth Junction, NJ, USA) and PI3K inhibitor (LY294002; Beyotime Biotechnology, Shanghai, China).

Techniques: Animal Model, Injection

Journal: PeerJ

Article Title: CCL25/CCR9 interaction promotes the malignant behavior of salivary adenoid cystic carcinoma via the PI3K/AKT signaling pathway.

doi: 10.7717/peerj.13844

Figure Lengend Snippet: Figure 8 CCL25/CCR9 promotes invasion and migration in a SACC xenograft mouse model by activating the PI3K/AKT signaling pathway. (A) The expression of tumor invasion- and metastasis-related factors (E-cadherin, vimentin and SLUG) in xenograft tumor tissues was detected by IHC staining. (B) The expression level was analyzed quantitatively (n = 5, one-way ANOVA followed by Tukey’s multiple comparisons; vs Control, P < 0.05, P < 0.01, P < 0.001; # vs CCL25, ###P < 0.001). (C, D) The protein expression of E-cadherin, vimentin and SLUG in xenograft tumors was measured by WB and statistically analyzed (n = 5, one-way ANOVA followed by Tukey’s multiple comparisons; vs Control, P < 0.05, P < 0.01; # vs CCL25, ##P < 0.01, ###P < 0.001). (E) The mRNA expression of E-cadherin, vimentin and SLUG in xenograft tumors was assessed by RT–qPCR (n = 3, one-way ANOVA followed by Tukey’s multiple comparisons; vs Control, P < 0.05, P < 0.01, P < 0.001; # vs CCL25, ##P < 0.01, ###P < 0.001). (F, G) The protein expression of ECM-related proteins (MMP2 and MMP9) in xenograft tumors and statistical analysis (n = 5, one-way ANOVA followed by Tukey’s multiple comparisons; vs Control, P < 0.05, P < 0.001; # vs CCL25, ###P < 0.001). (H) The mRNA expression levels of MMP2 and MMP9 were measured by RT–qPCR (n = 3, one-way ANOVA followed by Tukey’s multiple comparisons; vs Control, P < 0.001; # vs CCL25, ###P < 0.001). Data are presented as the mean ± SD. Full-size

Article Snippet: The main reagents involved in this study were CCL25 (#9046-TK-025/CF; R&D Systems Inc., Minneapolis, MN, USA), CCR9 inhibitor (Vercirnon, #GSK-1605786; MedchenExpress, Monmouth Junction, NJ, USA) and PI3K inhibitor (LY294002; Beyotime Biotechnology, Shanghai, China).

Techniques: Migration, Expressing, Immunohistochemistry, Control, Quantitative RT-PCR

Journal: PeerJ

Article Title: CCL25/CCR9 interaction promotes the malignant behavior of salivary adenoid cystic carcinoma via the PI3K/AKT signaling pathway.

doi: 10.7717/peerj.13844

Figure Lengend Snippet: Figure 9 Schematic model illustrating the PI3K/AKT pathway associated with CCRL25/CCR9-induced malignant biological behavior in SACC. CCL25 acts on CCR9, a G protein-coupled receptor located on the SACC cell membrane, resulting in activation of the G protein and release of the Gβγ subunit, thereby activating the PI3K/AKT signaling pathway. Vercirnon is a CCR9 inhibitor, and LY294002 is a blocker of the PI3K/AKT pathway. PI3K/AKT pathway activation can upregulate the mitochondrial-mediated anti-apoptotic factor BCL2, thus inhibiting caspase 3-dependent tumor cell apoptosis. Furthermore, CCL25 activation of the PI3K/AKT pathway leads to an increase in the expression of the cell cycle regulatory protein cyclin D1 and the protooncogene c-Myc, thus promoting the proliferation of tumor cells. Furthermore, the activation of the PI3K/ AKT pathway activates its downstream transcription factor SLUG, leading to regulation of the expression of EMT-related factors (E-cadherin and vimentin) and ECM degradation-related factors (MMPs), which enhances the migration and invasion abilities of SACC cells.

Article Snippet: The main reagents involved in this study were CCL25 (#9046-TK-025/CF; R&D Systems Inc., Minneapolis, MN, USA), CCR9 inhibitor (Vercirnon, #GSK-1605786; MedchenExpress, Monmouth Junction, NJ, USA) and PI3K inhibitor (LY294002; Beyotime Biotechnology, Shanghai, China).

Techniques: Membrane, Activation Assay, Expressing, Migration

Journal: Arthritis Research & Therapy

Article Title: Abrogation of CC chemokine receptor 9 ameliorates collagen-induced arthritis of mice

doi: 10.1186/s13075-014-0445-9

Figure Lengend Snippet: CCR9 and CCL25 expression in the RA synovial tissues. (A) Western blots of CCR9 protein expression in three RA and three OA synovial tissues. Ratio of CCR9/β-actin protein level is indicated below. (B-J) Sections of RA synovial tissue were double-stained with CCR9 and CD68, cadherin-11 and DC-LAMP (B, CD68; C, CCR9; D, merged B with C; E, cadherin-11; F, CCR9; G, merged E with F; H, DC-LAMP; I, CCR9; J, merged H with I). Bar, 20 μm. (K) Western blots of CCL25 protein expression in four RA and four OA synovial tissues. Ratio of CCL25/β-actin protein level is indicated below. (L-N) Sections of RA synovial tissue were double-stained with CCL25 and CD68 (L, CD68; M, CCL25; N, merged L with M). Bars, 20 μm. CCL, chemokine (C-C motif) ligand; CCR, CC chemokine receptor; DC-LAMP, dendritic cell lysosome-associated membrane glycoprotein; OA, osteoarthritis; RA, rheumatoid arthritis.

Article Snippet: RA FLS were cultured with 10% fetal calf serum (FCS) for 48 hours with or without recombinant human CCL25 (R&D Systems).

Techniques: Expressing, Western Blot, Staining, Membrane

Journal: Arthritis Research & Therapy

Article Title: Abrogation of CC chemokine receptor 9 ameliorates collagen-induced arthritis of mice

doi: 10.1186/s13075-014-0445-9

Figure Lengend Snippet: Effects of CCL25 on cultured RA FLS. (A) CCR9 expression on in vitro cultured RA FLS was determined by flow cytometry. Horizontal line indicates fluorescence intensity (FI). (B) RA FLS were cultured for 48 hours with various concentrations of CCL25. Concentrations of IL-6 (i) and MMP-3 (ii) in the culture supernatant were measured with ELISA. Values are the mean ± SEM of three independent experiments. * P <0.05. CCL, chemokine (C-C motif) ligand; CCR, CC chemokine receptor; ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocytes; IL, interleukin; MMP, metalloproteinase; RA, rheumatoid arthritis; SEM, standard error of the mean.

Article Snippet: RA FLS were cultured with 10% fetal calf serum (FCS) for 48 hours with or without recombinant human CCL25 (R&D Systems).

Techniques: Cell Culture, Expressing, In Vitro, Flow Cytometry, Fluorescence, Enzyme-linked Immunosorbent Assay

Journal: Arthritis Research & Therapy

Article Title: Abrogation of CC chemokine receptor 9 ameliorates collagen-induced arthritis of mice

doi: 10.1186/s13075-014-0445-9

Figure Lengend Snippet: Effects of CCL25 on human peripheral blood monocytes. (A) CCR9 expression on peripheral blood CD14 + monocytes was analyzed with flow cytometry. (B) Monocytes were cultured for 24 hours with various concentrations of CCL25. Concentrations of IL-6 (i) and TNF-α (ii) in the culture supernatant were measured with ELISA. Values are the mean ± SEM of three independent experiments. * P <0.05. CCL, chemokine (C-C motif) ligand; CCR, CC chemokine receptor; ELISA, enzyme-linked immunosorbent assay; IL, interleukin; SEM, standard error of the mean; TNF, tumor necrosis factor.

Article Snippet: RA FLS were cultured with 10% fetal calf serum (FCS) for 48 hours with or without recombinant human CCL25 (R&D Systems).

Techniques: Expressing, Flow Cytometry, Cell Culture, Enzyme-linked Immunosorbent Assay